Skip to main content

pCS2+N-3xFlag Cloning Vector
(Plasmid #196651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196651 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size (bp) 4100
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFlag (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
  • 3′ sequencing primer CACTGCATTCTAGTTCTGGT (CSR)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+N-3xFlag Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 196651 ; http://n2t.net/addgene:196651 ; RRID:Addgene_196651)