pBAD-6xHis-BglII
(Plasmid
#196654)
-
Purpose(Empty Backbone) Derived from pGLO (BioRad) by the insertion of a 6xHis Tag and a BglII site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGLO
-
Backbone manufacturerBio-Rad
- Backbone size (bp) 5371
-
Modifications to backboneInsertion of a linker in the original NheI site, coding for 6xHis tag and BglII site
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- 6xHis tag (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tctctactgtttctccatacccg
- 3′ sequencing primer atcagaccgcttctgcgttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-6xHis-BglII was a gift from Franco Lucchini (Addgene plasmid # 196654 ; http://n2t.net/addgene:196654 ; RRID:Addgene_196654) -
For your References section:
siRNAs pools generated in Escherichia coli exhibit strong RNA-interference activity against influenza virus genomic sequences. Villa R, Renzi S, Dotti S, Lucchini F. Virology. 2022 Dec 31;579:38-45. doi: 10.1016/j.virol.2022.12.013. 10.1016/j.virol.2022.12.013 PubMed 36599198