Skip to main content
Addgene

mBFP-APP-mGFP
(Plasmid #196694)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196694 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV6-AN-mGFP
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 9400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Amyloid Precursor Protein 695 isoform
  • Alt name
    amyloid beta precursor protein, APP, APP695
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3500
  • Entrez Gene
    APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mtagBFP2 (N terminal on insert)
    • mEGFP (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGACTTTCCAAAATGTCG
  • 3′ sequencing primer CCCACCAGCCTTGTCCTAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mBFP-APP-mGFP was a gift from Martino Calamai (Addgene plasmid # 196694 ; http://n2t.net/addgene:196694 ; RRID:Addgene_196694)
  • For your References section:

    APP and Bace1: Differential effect of cholesterol enrichment on processing and plasma membrane mobility. Capitini C, Bigi A, Parenti N, Emanuele M, Bianchi N, Cascella R, Cecchi C, Maggi L, Annunziato F, Pavone FS, Calamai M. iScience. 2023 Apr 11;26(5):106611. doi: 10.1016/j.isci.2023.106611. eCollection 2023 May 19. 10.1016/j.isci.2023.106611 PubMed 37128606

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More