Skip to main content

Guzit
(Bacterial strain #196902)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 196902 Bacteria in agar stab 1 $89

Backbone

  • Vector backbone
    this is a strain

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Guzit (Roesetta 2 derivative)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    8xHis-tag is attached to the N-terminus of rnhA (RNase HI) Kanamycin resistant gene is inserted upstream of rnhA

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers: (1)CACCAATCTCAATGATCTTGTGG, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)GCGTCCGCGATAGCGTAAA. Expected product size: 666 bp with primer (1) and (2), 1042 bp with primer (3) and (4).

Guzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system.

His-tagged RNase HI expressed from the rnhA gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnhA using the λ-Red recombination system.

Precuorsor strain is Rosseta 2.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Guzit was a gift from Kate Adamala (Addgene plasmid # 196902)
  • For your References section:

    A gene expression control technology for cell-free systems and synthetic cells via targeted gene silencing and transfection. Sato W, Rasmussen M, Gaut N, Devarajan M, Stokes K, Deich C, Engelhart AE, Adamala KP. Biotechnol Bioeng. 2023 Jul;120(7):1986-1997. doi: 10.1002/bit.28422. Epub 2023 May 9. 10.1002/bit.28422 PubMed 37159417