RNase III-His
(Bacterial strain
#196903)
-
PurposeRNase III-His is an E. coli strain made for a cell-free expression system.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 196903 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backbonethis is a strain
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)RNase III-His (Roesetta 2 derivative)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name"8xHis-tag is attached to the N-terminus of rnc (RNase III) Kanamycin resistant gene is inserted upstream of rnc"
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers: (1)AACGGCTATCTGGATGAGC, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)CGATGAGTTAATGCCTGCTGCA. Expected product size: 842 bp with primer (1) and (2), 1038 bp with primer (3) and (4).
RNase III-His is an E. coli strain made for a cell-free expression system.
His-tagged RNase III expressed from the rnc gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnc using the λ-Red recombination system.
Precuorsor strain is Rosseta 2.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RNase III-His was a gift from Kate Adamala (Addgene plasmid # 196903) -
For your References section:
A gene expression control technology for cell-free systems and synthetic cells via targeted gene silencing and transfection. Sato W, Rasmussen M, Gaut N, Devarajan M, Stokes K, Deich C, Engelhart AE, Adamala KP. Biotechnol Bioeng. 2023 Jul;120(7):1986-1997. doi: 10.1002/bit.28422. Epub 2023 May 9. 10.1002/bit.28422 PubMed 37159417