Skip to main content
Addgene

RNase III-His
(Bacterial strain #196903)

Print

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 196903 Bacteria in agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    this is a strain

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    RNase III-His (Roesetta 2 derivative)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    "8xHis-tag is attached to the N-terminus of rnc (RNase III) Kanamycin resistant gene is inserted upstream of rnc"

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers: (1)AACGGCTATCTGGATGAGC, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)CGATGAGTTAATGCCTGCTGCA. Expected product size: 842 bp with primer (1) and (2), 1038 bp with primer (3) and (4).

RNase III-His is an E. coli strain made for a cell-free expression system.

His-tagged RNase III expressed from the rnc gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnc using the λ-Red recombination system.

Precuorsor strain is Rosseta 2.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RNase III-His was a gift from Kate Adamala (Addgene plasmid # 196903)

  • For your References section:

    A gene expression control technology for cell-free systems and synthetic cells via targeted gene silencing and transfection. Sato W, Rasmussen M, Gaut N, Devarajan M, Stokes K, Deich C, Engelhart AE, Adamala KP. Biotechnol Bioeng. 2023 Jul;120(7):1986-1997. doi: 10.1002/bit.28422. Epub 2023 May 9. 10.1002/bit.28422 PubMed 37159417
Related items: