pGEX-6p-1_GST-SNAP-DmKHC[1-421]
(Plasmid
#196976)
-
PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with N-terminal SNAP tag and cleavable N-terminal GST
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX-6p-1
- Backbone size w/o insert (bp) 4971
- Total vector size (bp) 6817
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPurification from BL21. Induce protein expression with IPTG. After induction, grow at 18 degrees C.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinesin Heavy Chain
-
Alt nameKHC, Khc, kinesin-1
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1845
-
Entrez GeneKhc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
- Promoter tac
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- SNAP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAAGCCACGTTTGGTG
- 3′ sequencing primer GGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-6p-1_GST-SNAP-DmKHC[1-421] was a gift from Lukas Kapitein (Addgene plasmid # 196976 ; http://n2t.net/addgene:196976 ; RRID:Addgene_196976)