Skip to main content

pAAV-sCAG-GluClα.CreON
(Plasmid #196995)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196995 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4995
  • Total vector size (bp) 7104
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GluClα -Cerulean
  • Alt name
    GluCl-alpha -Cerulean
  • Alt name
    GluClv2.0 α Cerulean
  • Species
    C. elegans (nematode); c elegan
  • Insert Size (bp)
    2109
  • Promoter short CAG
  • Tag / Fusion Protein
    • Cerulean

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TAGGCGCGCCTCAGAACAGAACGTTCTGC
  • 3′ sequencing primer cacgatccacgtggccatggtggggctagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original construct for GluCl α (GluCl α v2.0 Opt α-GluClv2.0) were a gift from Henry Lester (Addgene plasmid 47542) (Frazier et al., 2013)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original GluClα (GluCl α v2.0 Opt α-GluClv2.0) (Frazier et al., 2013, PMID: 23720773)
GluClα-YFP, tag was exchanged for Cerulean and first used in the dorsal root ganglia (Weir et al., 2017, PMID: 28969375)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-sCAG-GluClα.CreON was a gift from David Bennett (Addgene plasmid # 196995 ; http://n2t.net/addgene:196995 ; RRID:Addgene_196995)
  • For your References section:

    GluCl.CreON enables selective inhibition of molecularly defined pain circuits. Middleton SJ, Hu H, Perez-Sanchez J, Zuberi S, McGrath Williams J, Weir GA, Bennett DL. Pain. 2023 Jun 27. doi: 10.1097/j.pain.0000000000002976. 10.1097/j.pain.0000000000002976 PubMed 37366588