pAAV-sCAG-GluClβ.CreON
(Plasmid
#196996)
-
PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4994
- Total vector size (bp) 7019
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGluClβ -YFP
-
Alt nameGluCl-beta -YFP
-
Alt nameGluClv2.0 β YFP
-
SpeciesC. elegans (nematode); c elegan
-
Insert Size (bp)2025
- Promoter short CAG
-
Tag
/ Fusion Protein
- YFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGcgcgccctacaccagggactcgggggt
- 3′ sequencing primer GCTAGCCCACCATGGCCACCCCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriginal construct for GluCl β (GluCl β v2.0 Opt β-GluClv2.0) were a gift from Henry Lester (Addgene plasmid 47542) (Frazier et al., 2013)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original GluClβ (GluCl β v2.0 Opt β-GluClv2.0) (Frazier et al., 2013, PMID: 23720773)
First use in Dorsal root ganglia (Weir et al., 2017, PMID: 28969375)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-sCAG-GluClβ.CreON was a gift from David Bennett (Addgene plasmid # 196996 ; http://n2t.net/addgene:196996 ; RRID:Addgene_196996) -
For your References section:
GluCl.CreON enables selective inhibition of molecularly defined pain circuits. Middleton SJ, Hu H, Perez-Sanchez J, Zuberi S, McGrath Williams J, Weir GA, Bennett DL. Pain. 2023 Jun 27. doi: 10.1097/j.pain.0000000000002976. 10.1097/j.pain.0000000000002976 PubMed 37366588