-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonederived from pMD.G see Addgene
-
Backbone manufacturersee Ref. for vector modif.
- Backbone size w/o insert (bp) 4421
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRabies virus CVS24-N2c glycoprotein
-
Alt nameviral glycoprotein
-
Alt nameCVS24 strain
-
Alt namerabies virus
-
SpeciesRabies virus
-
Insert Size (bp)1575
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (not destroyed)
- 3′ cloning site BsiW1 (not destroyed)
- 5′ sequencing primer TGTGTGCTGGCCCATCACTTTG
- 3′ sequencing primer ACTTTCTGATAGGCAGCCTGCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe gene of the rabies virus glycoprotein of the CVS24-N2c strain was obtained from Dr. Bernhard Dietzschold at Thomas Jefferson University in Philadelphia. It was PCR amplified while linkers were attached and was inserted into the new pMD.Link plasmid derived from pMD.G
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD.RVG.CVS24-N2c was a gift from Manfred Schubert (Addgene plasmid # 19712 ; http://n2t.net/addgene:19712 ; RRID:Addgene_19712) -
For your References section:
Transduction of motor neurons and muscle fibers by intramuscular injection of HIV-1-based vectors pseudotyped with select rabies virus glycoproteins. Mentis GZ, Gravell M, Hamilton R, Shneider NA, O'Donovan MJ, Schubert M. J Neurosci Methods. 2006 Oct 30. 157(2):208-17. 10.1016/j.jneumeth.2006.04.011 PubMed 16725205