pLentiCRISPRv2-bleo-ErbB4
              
              
                (Plasmid
                
                #197353)
              
            
            
            
          - 
            PurposeA knock-out vector for dog ErbB4.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneLentiCRISPR v2
- 
              Backbone manufacturerhttps://www.addgene.org/52961/
- 
              Vector typeLentiviral, CRISPR
- 
                Selectable markersZeocin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
- 
                    gRNA/shRNA sequenceATTGATGTCGGCTCAGACTG
- 
                  Insert Size (bp)6274
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLentiCRISPRv2-bleo-ErbB4 was a gift from Michiyuki Matsuda (Addgene plasmid # 197353 ; http://n2t.net/addgene:197353 ; RRID:Addgene_197353)
- 
                For your References section: Knockout of all ErbB-family genes delineates their roles in proliferation, survival, and migration. Matsuda K, Hirayama D, Hino N, Kuno S, Sakaue-Sawano A, Miyawaki A, Matsuda M, Terai K. J Cell Sci. 2023 Jul 31:jcs.261199. doi: 10.1242/jcs.261199. 10.1242/jcs.261199 PubMed 37519219
