Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPRv2-bleo-ErbB4
(Plasmid #197353)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 197353 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone manufacturer
    https://www.addgene.org/52961/
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
  • gRNA/shRNA sequence
    ATTGATGTCGGCTCAGACTG
  • Insert Size (bp)
    6274

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-bleo-ErbB4 was a gift from Michiyuki Matsuda (Addgene plasmid # 197353 ; http://n2t.net/addgene:197353 ; RRID:Addgene_197353)
  • For your References section:

    Knockout of all ErbB-family genes delineates their roles in proliferation, survival, and migration. Matsuda K, Hirayama D, Hino N, Kuno S, Sakaue-Sawano A, Miyawaki A, Matsuda M, Terai K. J Cell Sci. 2023 Jul 31:jcs.261199. doi: 10.1242/jcs.261199. 10.1242/jcs.261199 PubMed 37519219