pX459-dErbB2
(Plasmid
#197355)
-
PurposeA knock-out vector for dog ErbB2.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX459
-
Backbone manufacturerhttps://www.addgene.org/48139/
- Total vector size (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
-
gRNA/shRNA sequenceCAGAGGCTACGAATTGTGCG
-
Insert Size (bp)6274
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-dErbB2 was a gift from Michiyuki Matsuda (Addgene plasmid # 197355 ; http://n2t.net/addgene:197355 ; RRID:Addgene_197355) -
For your References section:
Knockout of all ErbB-family genes delineates their roles in proliferation, survival, and migration. Matsuda K, Hirayama D, Hino N, Kuno S, Sakaue-Sawano A, Miyawaki A, Matsuda M, Terai K. J Cell Sci. 2023 Jul 31:jcs.261199. doi: 10.1242/jcs.261199. 10.1242/jcs.261199 PubMed 37519219