Skip to main content
Addgene

pBK- Ma PylRS WT
(Plasmid #197573)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197573 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBK
  • Total vector size (bp) 2854
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    M. alvus PylRS WT
  • Species
    Methanomethylophilus alvus
  • Promoter GlnS (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tgctgagttgaaggatcctcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid only expresses the M. alvus Pyl tRNA synthetase and is used specifically for synthetase selections. It does not co-express the cognate Ma Pyl-tRNA. Libraries of Pyl-RS mutants can be built on this plasmid, and then paired with the M. alvus positive selection plasmid (197571), negative selection plasmid (197572) or fluorescence reporter plasmid (197574). This plasmid cannot be paired with with traditional E. coli expression vectors (e.g. pET, pBAD) for incorporation of non-canonical amino acids since it lacks expression of the cognate Pyl-tRNA and origin of replication compatibility issues.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK- Ma PylRS WT was a gift from Ryan Mehl (Addgene plasmid # 197573 ; http://n2t.net/addgene:197573 ; RRID:Addgene_197573)
  • For your References section:

    Generating Efficient Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetases for Structurally Diverse Non-Canonical Amino Acids. Avila-Crump S, Hemshorn ML, Jones CM, Mbengi L, Meyer K, Griffis JA, Jana S, Petrina GE, Pagar VV, Karplus PA, Petersson EJ, Perona JJ, Mehl RA, Cooley RB. ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16. 10.1021/acschembio.2c00639 PubMed 36383641