pCMVlux-cp157Venus
(Plasmid
#197584)
-
PurposeBRET lux luciferase with cp157Venus for mammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon-optimized Lux-cp157Venus
-
SpeciesSynthetic
- Promoter CMV promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATACCATATGGATCTCATGCAGAAGAACGGCATC
- 3′ sequencing primer TGATCCCCCACCGATCTTGTCGGCGGTGATATAGAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by490 Biotech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMVlux-cp157Venus was a gift from Takeharu Nagai (Addgene plasmid # 197584 ; http://n2t.net/addgene:197584 ; RRID:Addgene_197584) -
For your References section:
Enhanced brightness of bacterial luciferase by bioluminescence resonance energy transfer. Kaku T, Sugiura K, Entani T, Osabe K, Nagai T. Sci Rep. 2021 Jul 22;11(1):14994. doi: 10.1038/s41598-021-94551-4. 10.1038/s41598-021-94551-4 PubMed 34294849