Skip to main content

4A3.S'U'
(Plasmid #197676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC101 (4A3)
  • Backbone size w/o insert (bp) 3343
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    S'
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    2919
  • GenBank ID
    N/A N/A
  • Promoter Late S promoter, LPS

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaggcttcacaacattgattag
  • 3′ sequencing primer ttttgttttagggttgccag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    U'
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    532
  • GenBank ID
    N/A N/A
  • Promoter N/A

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcattaatgggacgtggtataac
  • 3′ sequencing primer ctcgagtgcggccgcaagcttgtcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4A3.S'U' was a gift from Baojun Wang (Addgene plasmid # 197676 ; http://n2t.net/addgene:197676 ; RRID:Addgene_197676)
  • For your References section:

    The Role of O-antigen in P1 Transduction of Shigella flexneri and Escherichia coli with its Alternative S' Tail Fibre. Huan YW, Fa-Arun J, Wang B. J Mol Biol. 2022 Sep 15;434(21):167829. doi: 10.1016/j.jmb.2022.167829. 10.1016/j.jmb.2022.167829 PubMed 36116540
Commonly requested with: