Skip to main content
Addgene

pminiT-mEmerald-MED1 donor
(Plasmid #197867)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197867 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pminiT
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 2525
  • Total vector size (bp) 4122
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRSP210
  • Alt name
    PBP; Pparbp; TRIP-2
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001080118.2 NP_001073587.1
  • Entrez Gene
    Med1 (a.k.a. CRSP210, DRIP205, PBP, Pparbp, TRAP220, TRIP-2, l11Jus15)
  • Promoter NA
  • Tag / Fusion Protein
    • mEmerald (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAAAGAGGAACGCAGAATG
  • 3′ sequencing primer CCCACCTCCTCTCTCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pminiT-mEmerald-MED1 donor was a gift from James Zhe Liu (Addgene plasmid # 197867 ; http://n2t.net/addgene:197867 ; RRID:Addgene_197867)
  • For your References section:

    Spatial organization of the 3D genome encodes gene co-expression programs in single cells. Dong P, Zhang S, Xie L, Wang L, Lemire AL, Lander AD, Chang HY, Liu ZJ. bioRxiv 2022.10.26.513917 10.1101/2022.10.26.513917