Skip to main content

4A3.PBAD-repL(AT2).J23115-gfp
(Plasmid #197873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC101 (4A3)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    part kilA/repL(AT2)
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    899
  • Promoter PBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cataagattagcggatcctacctgac
  • 3′ sequencing primer gttaaagctgttctcgctaagacattg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4A3.PBAD-repL(AT2).J23115-gfp was a gift from Baojun Wang (Addgene plasmid # 197873 ; http://n2t.net/addgene:197873 ; RRID:Addgene_197873)
  • For your References section:

    An adenine/thymidine-rich region is integral to RepL-mediated DNA replication. Huan YW, Brown R, Wang B. Front Microbiol. 2023 Feb 9;14:1095671. doi: 10.3389/fmicb.2023.1095671. eCollection 2023. 10.3389/fmicb.2023.1095671 PubMed 36846746