Skip to main content

pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut)
(Plasmid #197893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197893 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-MCS
  • Total vector size (bp) 6906
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 and DH5alpha are also suitable growth strains.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Discosoma sp.
  • Insert Size (bp)
    711
  • Mutation
    N/A
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggagtttccccacactga
  • 3′ sequencing primer cagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut) was a gift from Kazuto Kobayashi (Addgene plasmid # 197893 ; http://n2t.net/addgene:197893 ; RRID:Addgene_197893)
  • For your References section:

    Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence. Matsushita N, Kato S, Nishizawa K, Sugawara M, Takeuchi K, Miyasaka Y, Mashimo T, Kobayashi K. Cell Rep Methods. 2023 Jan 18;3(2):100393. doi: 10.1016/j.crmeth.2022.100393. eCollection 2023 Feb 27. 10.1016/j.crmeth.2022.100393 PubMed 36936079