pLVX-shRNA2-zsGreen-PGK-puro_HSALNG0104472-163
(Plasmid
#197902)
-
PurposeFor the stable knockdown experiments using shRNA, a complementary sequence (HSALNG0104472-163) targeting the HSALNG0104472 transcript was inserted.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLVX-shRNA2-zsGreen-PGK-puro
- Backbone size w/o insert (bp) 8998
- Total vector size (bp) 9038
-
Modifications to backboneA complementary sequence HSALNG0104472-163 (AGGGAACCAGCTTCAGAACTCAAGAGGTTCTGAAGCTGGTTCCCTTTTTTT) targeting the HSALNG0104472 transcript has been cloned into pLVX-shRNA2-zsGreen-PGK-puro by BamHI-EcoRI cloning site.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSALNG0104472-163 (HSALNG0104472-scramble-sequence)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)63
-
Mutation15q11.2 deletion
-
Tag
/ Fusion Protein
- zsGreen1 (C terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-shRNA2-zsGreen-PGK-puro_HSALNG0104472-163 was a gift from Bo Wang (Addgene plasmid # 197902 ; http://n2t.net/addgene:197902 ; RRID:Addgene_197902) -
For your References section:
Copy number variation-associated lncRNAs may contribute to the etiologies of congenital heart disease. Lu Y, Fang Q, Qi M, Li X, Zhang X, Lin Y, Xiang Y, Fu Q, Wang B. Commun Biol. 2023 Feb 17;6(1):189. doi: 10.1038/s42003-023-04565-z. 10.1038/s42003-023-04565-z PubMed 36806749