pC1300_pUB10_pcoCASphi_E9t_MCS_version1
(Plasmid
#197937)
-
PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the N-terminal and nucleoplasmin NLS at the C-terminal.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCambia1300
- Total vector size (bp) 14196
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepcoCasphi-2
-
Alt nameArabidopsis codon optimized Casphi-2
-
Alt nameCas12j2
-
SpeciesSynthetic
-
Insert Size (bp)2460
- Promoter pUBQ10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGATTTCTATCTAGATCTGGTGTTAGT
- 3′ sequencing primer CTGATGCATTGAACTTGACGAACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1300_pUB10_pcoCASphi_E9t_MCS_version1 was a gift from Steven Jacobsen (Addgene plasmid # 197937 ; http://n2t.net/addgene:197937 ; RRID:Addgene_197937) -
For your References section:
Genome editing in plants using the compact editor CasPhi. Li Z, Zhong Z, Wu Z, Pausch P, Al-Shayeb B, Amerasekera J, Doudna JA, Jacobsen SE. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2216822120. doi: 10.1073/pnas.2216822120. Epub 2023 Jan 18. 10.1073/pnas.2216822120 PubMed 36652483