Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pC1300_pUB10_pco-nCASphi_E9t_V2_U6_AtPDS3_gRNA10
(Plasmid #197965)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 197965 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCambia1300
  • Total vector size (bp) 14769
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pco-nCasphi-2
  • Alt name
    Arabidopsis codon optimized nCasphi-2
  • Species
    Synthetic
  • Insert Size (bp)
    2460
  • Promoter pUBQ10

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGATTTCTATCTAGATCTGGTGTTAGT
  • 3′ sequencing primer CTGATGCATTGAACTTGACGAACGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AtPDS3 gRNA10
  • Alt name
    AtPDS3 guide RNA10 driven by the AtU6-26 promoter
  • Species
    Synthetic
  • Promoter AtU6-26

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTAGAAGCTTCGTTGAACAACGGA
  • 3′ sequencing primer ACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1300_pUB10_pco-nCASphi_E9t_V2_U6_AtPDS3_gRNA10 was a gift from Steven Jacobsen (Addgene plasmid # 197965 ; http://n2t.net/addgene:197965 ; RRID:Addgene_197965)
  • For your References section:

    Genome editing in plants using the compact editor CasPhi. Li Z, Zhong Z, Wu Z, Pausch P, Al-Shayeb B, Amerasekera J, Doudna JA, Jacobsen SE. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2216822120. doi: 10.1073/pnas.2216822120. Epub 2023 Jan 18. 10.1073/pnas.2216822120 PubMed 36652483