Skip to main content
Addgene

pEGFP-U6
(Plasmid #19799)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19799 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size (bp) 5000
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    empty vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATATCCCTTGGAGAAAAGCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is modified from pEGFP-N1. Please see author's sequence for U6 modification. The modified MCS part with deletion of the fragment between Hind III and Xma I:

GCTAGCGCTACCGACTCAGATCTCGAGCTCAGATCCACCGGTCGCCACCATGGTG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-U6 was a gift from Zuoshang Xu (Addgene plasmid # 19799 ; http://n2t.net/addgene:19799 ; RRID:Addgene_19799)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 Oct 7;8:77. doi: 10.1186/1472-6750-8-77. 10.1186/1472-6750-8-77 PubMed 18840295