pLVX-shRNA2-zsGreen-PGK-puro_scramble shRNA
(Plasmid
#197991)
-
PurposeFor the stable knockdown experiments using shRNA, scramble sequence was inserted as the control.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLVX-shRNA2-zsGreen-PGK-puro
- Backbone size w/o insert (bp) 8998
- Total vector size (bp) 9038
-
Modifications to backboneThe scramble shRNA sequence, as control for knockdown experiments, has been cloned into pLVX-shRNA2-zsGreen-PGK-puro by BamHI-EcoRI cloning site.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescramble shRNA (control)
-
gRNA/shRNA sequenceCGTATACCCGGAACAAAGGTCAAGAGCCTTTGTTCCGGGTATACGTTTTTT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)63
-
Mutation15q11.2 deletion
-
Tag
/ Fusion Protein
- zsGreen1 (C terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-shRNA2-zsGreen-PGK-puro_scramble shRNA was a gift from Bo Wang (Addgene plasmid # 197991 ; http://n2t.net/addgene:197991 ; RRID:Addgene_197991) -
For your References section:
Copy number variation-associated lncRNAs may contribute to the etiologies of congenital heart disease. Lu Y, Fang Q, Qi M, Li X, Zhang X, Lin Y, Xiang Y, Fu Q, Wang B. Commun Biol. 2023 Feb 17;6(1):189. doi: 10.1038/s42003-023-04565-z. 10.1038/s42003-023-04565-z PubMed 36806749