eGFP-Silicatein-pET28
(Plasmid
#198012)
-
PurposeC-terminal eGFP fusion to truncated silicatein insert with N- and C-terminal hexahistidine tag for purification
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP-silicatein
-
SpeciesSynthetic
-
Insert Size (bp)1500
- Promoter T7
-
Tags
/ Fusion Proteins
- hexahistidine tag (N terminal on backbone)
- hexahistidine tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gggtcgcggatccATGGT
- 3′ sequencing primer CCCACCCTCGAGTTGATTGTATTTGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP-Silicatein-pET28 was a gift from Bryan Berger (Addgene plasmid # 198012 ; http://n2t.net/addgene:198012 ; RRID:Addgene_198012) -
For your References section:
Understanding the relationships between solubility, stability, and activity of silicatein. Vigil TN, Rowson MC, Frosta AJ, Berger BW. Materials Advances 2, 2023 10.1039/D2MA00938B