Skip to main content

pIBA2-IntHA453-SpyTag
(Plasmid #198039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198039 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pASK-IBA2
  • Backbone manufacturer
    IBA Lifescience
  • Backbone size w/o insert (bp) 2826
  • Total vector size (bp) 6007
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eaeA
  • Alt name
    intimin
  • Species
    Escherichia coli
  • Insert Size (bp)
    2943
  • Mutation
    double HA tag inserted at position 453; lacks native signal peptide (amino acids 1-39)
  • GenBank ID
    WP_000627890 E2348C_RS21125
  • Promoter tet
  • Tag / Fusion Protein
    • SpyTag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTTATTTTACCACTCCCT
  • 3′ sequencing primer CGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Monika Schuetz, University Clinics Tuebingen, Tuebingen, Germany

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIBA2-IntHA453-SpyTag was a gift from Jack Leo (Addgene plasmid # 198039 ; http://n2t.net/addgene:198039 ; RRID:Addgene_198039)
  • For your References section:

    Fluorescent Labeling of Outer Membrane Proteins Using the SpyCatcher-SpyTag System. Duodu R, Linke D, Leo JC. Methods Mol Biol. 2024;2778:53-63. doi: 10.1007/978-1-0716-3734-0_4. 10.1007/978-1-0716-3734-0_4 PubMed 38478271