pCL040 lenti TRE-3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherry-BSD-WPRE
(Plasmid
#198054)
-
PurposeAll-in-one lentiviral backbone for doxycycline-inducible expression of a 3xFLAG-tagged protein of interest, which can be inserted with Golden Gate cloning
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJT126
-
Modifications to backboneUsed assembly PCR to construct a cassette with a TRE3G promoter followed by a 3xFLAG tag, a Golden Gate library cloning site, an SV40 polyA tail, and the core sequence of the chicken HS4 insulator; used Gibson to clone in between the NotI and NsiI restriction sites. Used assembly PCR and Gibson cloning to replace the rTetR(SE-G72P)-3xFLAG-LibCloneSite with rTetR(SEG72P)-VP48.
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namerTetR(SE-G72P)-VP48-T2A-mCherry-BSD
-
SpeciesSynthetic
-
Insert Size (bp)1929
- Promoter pEF
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3xFLAG-insert
-
SpeciesSynthetic
-
Insert Size (bp)117
- Promoter TRE3G
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tgcaggggaaagaatagtagac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.12.16.520835v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCL040 lenti TRE-3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherry-BSD-WPRE was a gift from Lacra Bintu (Addgene plasmid # 198054 ; http://n2t.net/addgene:198054 ; RRID:Addgene_198054) -
For your References section:
High-throughput discovery and characterization of viral transcriptional effectors in human cells. Ludwig CH, Thurm AR, Morgens DW, Yang KJ, Tycko J, Bassik MC, Glaunsinger BA, Bintu L. Cell Syst. 2023 Jun 21;14(6):482-500.e8. doi: 10.1016/j.cels.2023.05.008. 10.1016/j.cels.2023.05.008 PubMed 37348463