pCL040 lenti TRE-3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherry-BSD-WPRE
(Plasmid #198054)

• Purpose: All-in-one lentiviral backbone for doxycycline-inducible expression of a 3xFLAG-tagged protein of interest, which can be inserted with Golden Gate cloning
• Depositing Lab: Lacra Bintu
• Publication: Ludwig et al Cell Syst. 2023 Jun 21;14(6):482-500.e8. doi: 10.1016/j.cels.2023.05.008.

Backbone

• Vector backbone: pJT126
• Modifications to backbone: Used assembly PCR to construct a cassette with a TRE3G promoter followed by a 3xFLAG tag, a Golden Gate library cloning site, an SV40 polyA tail, and the core sequence of the chicken HS4 insulator; used Gibson to clone in between the NotI and NsiI restriction sites. Used assembly PCR and Gibson cloning to replace the rTetR(SE-G72P)-3xFLAG-LibCloneSite with rTetR(SEG72P)-VP48.
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: rTetR(SE-G72P)-VP48-T2A-mCherry-BSD
• Species: Synthetic
• Insert Size (bp): 1929
• Promoter: pEF

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAAGCCTCAGACAGTGGTTC

Gene/Insert 2

• Gene/Insert name: 3xFLAG-insert
• Species: Synthetic
• Insert Size (bp): 117
• Promoter: TRE3G
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgcaggggaaagaatagtagac

Resource Information

• Supplemental Documents:
  • pCL040 lenti TRE 3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherry-BSD-WPRE.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.12.16.520835v1 for bioRxiv preprint.