pCSIIbleo-iRFP713(V256C)-P2A-EGFP
(Plasmid
#198061)
-
PurposeThe lentiviral vector for iRFP713(V256C) and EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCSIIbleo
- Backbone size w/o insert (bp) 10120
- Total vector size (bp) 11833
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP713(V256C)
-
SpeciesSynthetic
-
Insert Size (bp)1710
-
MutationV256C mutation
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCATTCTCAAGCCTCAGACAGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Vladislav Verkhusha (Addgene plasmid # 45468: pNLS-iRFP713)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSIIbleo-iRFP713(V256C)-P2A-EGFP was a gift from Michiyuki Matsuda (Addgene plasmid # 198061 ; http://n2t.net/addgene:198061 ; RRID:Addgene_198061)