Skip to main content
Addgene

pCI-neo-μ2-(HA)3
(Plasmid #198178)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198178 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 6872
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AP-2 μ2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1428
  • Mutation
    silent substitution in codon 80
  • Promoter CMV
  • Tag / Fusion Protein
    • triple HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

μ2 + linker + HA tag subcloned between EcoRI and SalI sites; double HA tag subcloned between SalI and NotI sites (SalI site destroyed)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo-μ2-(HA)3 was a gift from Juan Bonifacino (Addgene plasmid # 198178 ; http://n2t.net/addgene:198178 ; RRID:Addgene_198178)
  • For your References section:

    Co-assembly of viral envelope glycoproteins regulates their polarized sorting in neurons. Mattera R, Farias GG, Mardones GA, Bonifacino JS. PLoS Pathog. 2014 May 15;10(5):e1004107. doi: 10.1371/journal.ppat.1004107. eCollection 2014 May. 10.1371/journal.ppat.1004107 PubMed 24831812