pcmv3-IRG1-H159Q-HA
(Plasmid
#198183)
-
PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) H159Q
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcmv3
- Total vector size (bp) -1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameACOD1
-
Alt nameIRG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1446
-
MutationThe histidine in IRG1 at position 159 mutates to glutarnine
-
GenBank IDNM_001258406.2
-
Entrez GeneACOD1 (a.k.a. CAD, IRG1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGCCATACACTTGAGTGAC
- 3′ sequencing primer ACAGTGGGAGTGGCACCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcmv3-IRG1-H159Q-HA was a gift from Yun Zhao (Addgene plasmid # 198183 ; http://n2t.net/addgene:198183 ; RRID:Addgene_198183) -
For your References section:
4-octyl itaconate as a metabolite derivative inhibits inflammation via alkylation of STING. Li W, Li Y, Kang J, Jiang H, Gong W, Chen L, Wu C, Liu M, Wu X, Zhao Y, Ren J. Cell Rep. 2023 Mar 28;42(3):112145. doi: 10.1016/j.celrep.2023.112145. Epub 2023 Feb 28. 10.1016/j.celrep.2023.112145 PubMed 36862550