Skip to main content

pcmv3-STING-C88S-FLAG
(Plasmid #198187)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198187 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcmv3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TMEM173
  • Alt name
    STING
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1176
  • GenBank ID
    NM_028261.1
  • Entrez Gene
    Sting1 (a.k.a. 2610307O08Rik, ERIS, MPYS, Mita, STING, STING-beta, Tmem173)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGCCATACACTTGAGTGAC
  • 3′ sequencing primer ACAGTGGGAGTGGCACCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcmv3-STING-C88S-FLAG was a gift from Yun Zhao (Addgene plasmid # 198187 ; http://n2t.net/addgene:198187 ; RRID:Addgene_198187)
  • For your References section:

    4-octyl itaconate as a metabolite derivative inhibits inflammation via alkylation of STING. Li W, Li Y, Kang J, Jiang H, Gong W, Chen L, Wu C, Liu M, Wu X, Zhao Y, Ren J. Cell Rep. 2023 Mar 28;42(3):112145. doi: 10.1016/j.celrep.2023.112145. Epub 2023 Feb 28. 10.1016/j.celrep.2023.112145 PubMed 36862550