mVenus
(Plasmid
#198192)
-
PurposeSpectral correction: Expression of mVenus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1+
- Backbone size w/o insert (bp) 5401
- Total vector size (bp) 6121
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus
-
Alt namemVen
-
SpeciesA. victoria
-
Insert Size (bp)720
-
MutationA206K
-
GenBank IDAAZ65844.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mVenus was a gift from Christian Wahl-Schott (Addgene plasmid # 198192 ; http://n2t.net/addgene:198192 ; RRID:Addgene_198192) -
For your References section:
Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative two-hybrid FRET. Feldmann C, Schanzler M, Ben-Johny M, Wahl-Schott C. STAR Protoc. 2023 Jul 28;4(3):102459. doi: 10.1016/j.xpro.2023.102459. 10.1016/j.xpro.2023.102459 PubMed 37516972