Dimer cleaved
(Plasmid
#198199)
-
PurposeFRET calibration: Dimer construct consisting of mTurquoise2 and mVenus with a 2A peptide linker for posttranslational linker cleavage
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3931
- Total vector size (bp) 5449
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus-T2A-mTurquoise2
-
SpeciesSynthetic
-
MutationA206K both
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original plasmid mNeonGreen-2A-mTurquoise2 was a gift from Dorus Gadella (Addgene plasmid # 98885 ; http://n2t.net/addgene:98885 ; RRID:Addgene_98885)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dimer cleaved was a gift from Christian Wahl-Schott (Addgene plasmid # 198199 ; http://n2t.net/addgene:198199 ; RRID:Addgene_198199) -
For your References section:
Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative two-hybrid FRET. Feldmann C, Schanzler M, Ben-Johny M, Wahl-Schott C. STAR Protoc. 2023 Jul 28;4(3):102459. doi: 10.1016/j.xpro.2023.102459. 10.1016/j.xpro.2023.102459 PubMed 37516972