Skip to main content
Addgene

mVenus-IQ6 WT
(Plasmid #198201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198201 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5335
  • Total vector size (bp) 6166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MYO5A IQ domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    831
  • GenBank ID
    NM_010864.2
  • Entrez Gene
    Myo5a (a.k.a. 9630007J19Rik, Dbv, MVa, Myo5, MyoVA, Sev-1, d, d-120J, flail, flr)
  • Tag / Fusion Protein
    • mVenus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mVenus-IQ6 WT was a gift from Christian Wahl-Schott (Addgene plasmid # 198201 ; http://n2t.net/addgene:198201 ; RRID:Addgene_198201)
  • For your References section:

    Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative two-hybrid FRET. Feldmann C, Schanzler M, Ben-Johny M, Wahl-Schott C. STAR Protoc. 2023 Jul 28;4(3):102459. doi: 10.1016/j.xpro.2023.102459. 10.1016/j.xpro.2023.102459 PubMed 37516972