pAGH10 - RlucFluc minus 1 HIV-1
(Plasmid
#198224)
-
PurposeFluorescence reporters for -1 ribosomal frameshifting in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerAddgene 12177
- Backbone size w/o insert (bp) 3746
- Total vector size (bp) 5421
-
Modifications to backboneInsertion of human-codon optimized Renilla luciferase, -1 HIV sequence, and firefly luciferase
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRenilla luciferase
-
SpeciesRenilla reniformis
-
Insert Size (bp)933
- Promoter SV40
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer cactttgcctttctctccac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFirefly luciferase
-
SpeciesFirefly (Photinus pyralis)
-
Insert Size (bp)1653
- Promoter SV40
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer cactttgcctttctctccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGH10 - RlucFluc minus 1 HIV-1 was a gift from Isha Jain (Addgene plasmid # 198224 ; http://n2t.net/addgene:198224 ; RRID:Addgene_198224)