pMX-Ascl1-puro
(Plasmid
#198227)
-
PurposeRetroviral expression of Ascl1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMX
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAscl1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)696
-
Entrez GeneAscl1 (a.k.a. ASH1, Mash1, bHLHa46)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site BstXI (unknown if destroyed)
- 5′ sequencing primer CGCCCACGTGAAGGCTGCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-Ascl1-puro was a gift from Li Qian (Addgene plasmid # 198227 ; http://n2t.net/addgene:198227 ; RRID:Addgene_198227) -
For your References section:
Cross-lineage potential of Ascl1 uncovered by comparing diverse reprogramming regulatomes. Wang H, Keepers B, Qian Y, Xie Y, Colon M, Liu J, Qian L. Cell Stem Cell. 2022 Oct 6;29(10):1491-1504.e9. doi: 10.1016/j.stem.2022.09.006. 10.1016/j.stem.2022.09.006 PubMed 36206732