Skip to main content

pBUE411-B
(Plasmid #198234)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBUE411
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 18709
  • Vector type
    Plant Expression, CRISPR ; plant binary vector
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pPLTP::BBM cassette
  • Species
    Zea mays; Agrobacterium tumefaciens
  • Insert Size (bp)
    3582
  • Promoter PLTP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (destroyed during cloning)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer GCGCCACGCTGCTACTGCTGCTAC
  • 3′ sequencing primer ttctgcaggCGCGCTAATTCCCGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBUE411-B was a gift from Andrea Gallavotti (Addgene plasmid # 198234 ; http://n2t.net/addgene:198234 ; RRID:Addgene_198234)
  • For your References section:

    The combination of morphogenic regulators BABY BOOM and GRF-GIF improves maize transformation efficiency. Chen Z, Debernardi JM, Dubcovsky J, Gallavotti A. bioRxiv 2022.09.02.506370 10.1101/2022.09.02.506370