pcDNA3.4_17G6-1 heavy chain
(Plasmid
#198249)
-
Purposerecombinant expression of heavy chain of monoclonal anti-AMP antibody 17G6-1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.4
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7417
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameheavy chain of monoclonal anti-AMP antibody 17G6-1 (mouse IgG2b)
-
Alt name17G6 HC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1464
- Promoter CMV
-
Tag
/ Fusion Protein
- IL10 signal peptide (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene synthesis and cloning was a service of Biointron Biological Inc.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.4_17G6-1 heavy chain was a gift from Aymelt Itzen (Addgene plasmid # 198249 ; http://n2t.net/addgene:198249 ; RRID:Addgene_198249) -
For your References section:
Monoclonal Anti-AMP Antibodies Are Sensitive and Valuable Tools for Detecting Patterns of AMPylation. Hopfner D, Fauser J, Kaspers MS, Pett C, Hedberg C, Itzen A. iScience. 2020 Nov 13;23(12):101800. doi: 10.1016/j.isci.2020.101800. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101800 PubMed 33299971