py100-sgRNA_hVEGFA
(Plasmid
#198282)
-
PurposeExpression of SpCas9 guide RNA specific for human VEGFA locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepy100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepy100-sgRNA_hVEGFA
-
gRNA/shRNA sequenceggtgagtgagtgtgtgcgtg
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
py100-sgRNA_hVEGFA was a gift from Feng Zhang (Addgene plasmid # 198282 ; http://n2t.net/addgene:198282 ; RRID:Addgene_198282) -
For your References section:
Programmable protein delivery with a bacterial contractile injection system. Kreitz J, Friedrich MJ, Guru A, Lash B, Saito M, Macrae RK, Zhang F. Nature. 2023 Apr;616(7956):357-364. doi: 10.1038/s41586-023-05870-7. Epub 2023 Mar 29. 10.1038/s41586-023-05870-7 PubMed 36991127