p-mCherry2-sgC9cen
(Plasmid
#198326)
-
PurposeExpresses a guide RNA against a repetitive locus found in the pericentromere of human chromosome 9, with mCherry2 reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-sgRNA (empty)
-
Backbone manufacturerAddgene 198330
- Backbone size w/o insert (bp) 5258
- Total vector size (bp) 5133
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChr9-CEN guide RNA
-
gRNA/shRNA sequenceTGGAATGGAATGGAATGGAA
-
Insert Size (bp)25
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer tacaccatcgtggaacagta
- 3′ sequencing primer gaggtgtgggaggtttttta
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Chr9-CEN target sequence: TGGAATGGAATGGAATGGAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-mCherry2-sgC9cen was a gift from Sarah McClelland (Addgene plasmid # 198326 ; http://n2t.net/addgene:198326 ; RRID:Addgene_198326) -
For your References section:
Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065