p-mCherry2-sgMUC4
(Plasmid
#198399)
-
PurposeExpresses a guide RNA against a repetitive locus found in the MUC4 gene of human chromosome 3, with mCherry2 reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmCherry-sgRNA (empty)
-
Backbone manufacturerAddgene 198330
- Backbone size w/o insert (bp) 5258
- Total vector size (bp) 5133
-
Modifications to backboneInsertion of sgMUC4
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMUC4 sgRNA
-
gRNA/shRNA sequenceGGCGTGACCTGTGGATGCTG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)25
-
Entrez GeneMUC4 (a.k.a. ASGP, HSA276359, MUC-4)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer gcttaccgtaacttgaaagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-mCherry2-sgMUC4 was a gift from Sarah McClelland (Addgene plasmid # 198399 ; http://n2t.net/addgene:198399 ; RRID:Addgene_198399) -
For your References section:
Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065