Skip to main content

Mouse DsRed-Monomer CASP9 C325A Mutant
(Plasmid #198401)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198401 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDsRed-Monomer-Hyg-C1
  • Backbone manufacturer
    Takara Bio USA
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7104
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse Caspase-9 C325A Mutant
  • Alt name
    CASP-9; ICE-LAP6; Mch6; APAF-3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1404
  • Mutation
    Changed Cysteine 325 to Alanine to eliminate protease activity
  • GenBank ID
    NM_015733.5
  • Entrez Gene
    Casp9 (a.k.a. APAF-3, CASP-9, Caspase-9, ICE-LAP6, Mch6)
  • Promoter CMV
  • Tag / Fusion Protein
    • DsRed-monomer (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site Kpn I (not destroyed)
  • 5′ sequencing primer TACAAGGCCAAGAAGCCCGTG
  • 3′ sequencing primer GCTGATTATGATCAGTTATCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

S586L point mutation in CASP-9 in addition to C325A mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mouse DsRed-Monomer CASP9 C325A Mutant was a gift from Hannah Rabinowich (Addgene plasmid # 198401 ; http://n2t.net/addgene:198401 ; RRID:Addgene_198401)
  • For your References section:

    Involvement of CASP9 (caspase 9) in IGF2R/CI-MPR endosomal transport. Han J, Goldstein LA, Hou W, Watkins SC, Rabinowich H. Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25. 10.1080/15548627.2020.1761742 PubMed 32397873