pPRC6-ProD
(Plasmid
#198431)
-
Purposemkate2 fluorescent reporter gene under control of promoter ProD. Used as a control plasmid in reporter gene assays.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPRC6
-
Backbone manufacturerAmber Bernauw
- Backbone size w/o insert (bp) 3186
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemKate2
-
SpeciesSynthetic
-
Insert Size (bp)699
- Promoter ProD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtccagatagcccagtagctgacattc
- 3′ sequencing primer GTGAAACTGACCGACCAATACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPRC6-ProD was a gift from Eveline Peeters (Addgene plasmid # 198431 ; http://n2t.net/addgene:198431 ; RRID:Addgene_198431) -
For your References section:
Molecular mechanisms of regulation by a beta-alanine-responsive Lrp-type transcription factor from Acidianus hospitalis. Bernauw AJ, Crabbe V, Ryssegem F, Willaert R, Bervoets I, Peeters E. Microbiologyopen. 2023 Jun;12(3):e1356. doi: 10.1002/mbo3.1356. 10.1002/mbo3.1356 PubMed 37379425