Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPRC6-ProD
(Plasmid #198431)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198431 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPRC6
  • Backbone manufacturer
    Amber Bernauw
  • Backbone size w/o insert (bp) 3186
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mKate2
  • Species
    Synthetic
  • Insert Size (bp)
    699
  • Promoter ProD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtccagatagcccagtagctgacattc
  • 3′ sequencing primer GTGAAACTGACCGACCAATACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRC6-ProD was a gift from Eveline Peeters (Addgene plasmid # 198431 ; http://n2t.net/addgene:198431 ; RRID:Addgene_198431)
  • For your References section:

    Molecular mechanisms of regulation by a beta-alanine-responsive Lrp-type transcription factor from Acidianus hospitalis. Bernauw AJ, Crabbe V, Ryssegem F, Willaert R, Bervoets I, Peeters E. Microbiologyopen. 2023 Jun;12(3):e1356. doi: 10.1002/mbo3.1356. 10.1002/mbo3.1356 PubMed 37379425