Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Lenti-guide-puro mRab12-2
(Plasmid #198476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198476 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lenti-guide puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse Rab12
  • gRNA/shRNA sequence
    ATATACGAGTATGATCCCCT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Rab12 (a.k.a. 2900054P15Rik)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer gcctatttcccatgattccttc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-guide-puro mRab12-2 was a gift from Suzanne Pfeffer (Addgene plasmid # 198476 ; http://n2t.net/addgene:198476 ; RRID:Addgene_198476)
  • For your References section:

    Genome-wide screen reveals Rab12 GTPase as a critical activator of pathogenic LRRK2 kinase. Dhekne H.S., Tonelli F., Yeshaw W.M., Chiang C.Y., Limouse C., Jaimon E., Purlyte E., Alessi D.R., Pfeffer S.R.. BioRxiv February 2023 10.1101/2023.02.17.529028