PX458-SPNS1-sg1
(Plasmid
#198566)
-
PurposeSPNS1-targeting sgRNA in PX458 vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 9288
- Total vector size (bp) 9288
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSPNS1-sg1
-
Alt nameSPNS1 sgRNA-1
-
gRNA/shRNA sequenceGTCGGCCACAAAGAGGT
-
SpeciesH. sapiens (human)
-
Entrez GeneSPNS1 (a.k.a. HSpin1, LAT, PP2030, SLC62A1, SLC63A1, SPIN1, SPINL, nrs)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.11.27.517422v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-SPNS1-sg1 was a gift from Monther Abu-Remaileh (Addgene plasmid # 198566 ; http://n2t.net/addgene:198566 ; RRID:Addgene_198566) -
For your References section:
An SPNS1-dependent lysosomal lipid transport pathway that enables cell survival under choline limitation. Scharenberg SG, Dong W, Ghoochani A, Nyame K, Levin-Konigsberg R, Krishnan AR, Rawat ES, Spees K, Bassik MC, Abu-Remaileh M. Sci Adv. 2023 Apr 21;9(16):eadf8966. doi: 10.1126/sciadv.adf8966. Epub 2023 Apr 19. 10.1126/sciadv.adf8966 PubMed 37075117