Skip to main content

PX458-SPNS1-sg1
(Plasmid #198566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 9288
  • Total vector size (bp) 9288
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SPNS1-sg1
  • Alt name
    SPNS1 sgRNA-1
  • gRNA/shRNA sequence
    GTCGGCCACAAAGAGGT
  • Species
    H. sapiens (human)
  • Entrez Gene
    SPNS1 (a.k.a. HSpin1, LAT, PP2030, SLC62A1, SLC63A1, SPIN1, SPINL, nrs)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-SPNS1-sg1 was a gift from Monther Abu-Remaileh (Addgene plasmid # 198566 ; http://n2t.net/addgene:198566 ; RRID:Addgene_198566)
  • For your References section:

    An SPNS1-dependent lysosomal lipid transport pathway that enables cell survival under choline limitation. Scharenberg SG, Dong W, Ghoochani A, Nyame K, Levin-Konigsberg R, Krishnan AR, Rawat ES, Spees K, Bassik MC, Abu-Remaileh M. Sci Adv. 2023 Apr 21;9(16):eadf8966. doi: 10.1126/sciadv.adf8966. Epub 2023 Apr 19. 10.1126/sciadv.adf8966 PubMed 37075117