pLC133
(Plasmid
#198639)
-
PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9
-
Alt namedead-Cas9
-
Alt nameSpyCas9
-
Alt nameSpCas9
- Promoter pTet
-
Tag
/ Fusion Protein
- 3x-FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTTTAGGTTAGGCGCCAT
- 3′ sequencing primer ATTTGGATCCCCTCGAGTTCATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLC133 was a gift from David Bikard (Addgene plasmid # 198639 ; http://n2t.net/addgene:198639 ; RRID:Addgene_198639) -
For your References section:
Cas9 off-target binding to the promoter of bacterial genes leads to silencing and toxicity. Rostain W, Grebert T, Vyhovskyi D, Pizarro PT, Tshinsele-Van Bellingen G, Cui L, Bikard D. Nucleic Acids Res. 2023 Mar 17:gkad170. doi: 10.1093/nar/gkad170. 10.1093/nar/gkad170 PubMed 36929199