pcDNA 3.1-NbON10-NanoLuc
(Plasmid
#198691)
-
PurposeExpresses anti-SARS-Cov-2 Nucleocapsid nanobody ON10 fused to NanoLuc in HEK293 cell culture
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 6220
- Total vector size (bp) 4979
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-SARS-CoV-2 Nucleocapsid nanobody ON10
-
Alt nameNbON10
-
Insert Size (bp)1241
- Promoter CMV promoter
-
Tags
/ Fusion Proteins
- IgK leader sequence (N terminal on insert)
- NanoLuc (C terminal on insert)
- 6xHis tag (C terminal on insert)
- twin-strep-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCGACTGTGCCTTCTA (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 3.1-NbON10-NanoLuc was a gift from Gualberto González Sapienza (Addgene plasmid # 198691 ; http://n2t.net/addgene:198691 ; RRID:Addgene_198691) -
For your References section:
A highly sensitive nanobody-based immunoassay detecting SARS-CoV-2 nucleocapsid protein using all-recombinant reagents. Segovia-de Los Santos P, Padula-Roca C, Simon X, Echaides C, Lassabe G, Gonzalez-Sapienza G. Front Immunol. 2023 Jul 11;14:1220477. doi: 10.3389/fimmu.2023.1220477. eCollection 2023. 10.3389/fimmu.2023.1220477 PubMed 37497229