Skip to main content

pcDNA 3.1-NbON10-NanoLuc
(Plasmid #198691)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198691 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 6220
  • Total vector size (bp) 4979
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-SARS-CoV-2 Nucleocapsid nanobody ON10
  • Alt name
    NbON10
  • Insert Size (bp)
    1241
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • IgK leader sequence (N terminal on insert)
    • NanoLuc (C terminal on insert)
    • 6xHis tag (C terminal on insert)
    • twin-strep-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.1-NbON10-NanoLuc was a gift from Gualberto González Sapienza (Addgene plasmid # 198691 ; http://n2t.net/addgene:198691 ; RRID:Addgene_198691)
  • For your References section:

    A highly sensitive nanobody-based immunoassay detecting SARS-CoV-2 nucleocapsid protein using all-recombinant reagents. Segovia-de Los Santos P, Padula-Roca C, Simon X, Echaides C, Lassabe G, Gonzalez-Sapienza G. Front Immunol. 2023 Jul 11;14:1220477. doi: 10.3389/fimmu.2023.1220477. eCollection 2023. 10.3389/fimmu.2023.1220477 PubMed 37497229