Lenti-SAM-Cre
(Plasmid
#198714)
-
PurposeFor expression of guide RNAs, the SAM transcriptional activator for CRISPRa and Cre in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198714 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLenti-Trono
- Backbone size w/o insert (bp) 7631
- Total vector size (bp) 11152
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6-MS2-gRNAscaffold
-
Alt nameU6 promoter
-
Alt nameMS2 stem loops
-
Alt nameguide RNA cloning cassette
-
Insert Size (bp)405
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCAGTGTGAGGGAGTGTAAAGCTGGTTT
- 3′ sequencing primer AGAGTAATTCAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePgk-MPH-Cre
-
Alt namePgk promoter
-
Alt nameMS2 binding protein and p65, HSF1 transcriptional activators
-
Alt nameCre recombinase
-
Insert Size (bp)3079
- Promoter Pgk
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AAACCGCTGTTCCTAGGAATCCCGAGGCCT
- 3′ sequencing primer AGAGTAATTCAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.08.11.503237v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-SAM-Cre was a gift from Tyler Jacks (Addgene plasmid # 198714 ; http://n2t.net/addgene:198714 ; RRID:Addgene_198714) -
For your References section:
Lymphocyte networks are dynamic cellular communities in the immunoregulatory landscape of lung adenocarcinoma. Gaglia G, Burger ML, Ritch CC, Rammos D, Dai Y, Crossland GE, Tavana SZ, Warchol S, Jaeger AM, Naranjo S, Coy S, Nirmal AJ, Krueger R, Lin JR, Pfister H, Sorger PK, Jacks T, Santagata S. Cancer Cell. 2023 May 8;41(5):871-886.e10. doi: 10.1016/j.ccell.2023.03.015. Epub 2023 Apr 13. 10.1016/j.ccell.2023.03.015 PubMed 37059105