Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_CaMKIIa_SERT_mCherry
(Plasmid #198736)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198736 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone size w/o insert (bp) 5361
  • Total vector size (bp) 7980
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Serotonin transporter and mCherry
  • Alt name
    SERT-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    2619
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGAAGGCTCGCGAGGCTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_CaMKIIa_SERT_mCherry was a gift from Lin Tian (Addgene plasmid # 198736 ; http://n2t.net/addgene:198736 ; RRID:Addgene_198736)
  • For your References section:

    Psychedelics promote neuroplasticity through the activation of intracellular 5-HT2A receptors. Vargas MV, Dunlap LE, Dong C, Carter SJ, Tombari RJ, Jami SA, Cameron LP, Patel SD, Hennessey JJ, Saeger HN, McCorvy JD, Gray JA, Tian L, Olson DE. Science. 2023 Feb 17;379(6633):700-706. doi: 10.1126/science.adf0435. Epub 2023 Feb 16. 10.1126/science.adf0435 PubMed 36795823