Skip to main content
Addgene

pAAV_CaMKIIa_SERT_EYFP
(Plasmid #198737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198737 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone size w/o insert (bp) 5367
  • Total vector size (bp) 7995
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Serotonin transporter and yellow fluorescent protein
  • Alt name
    SERT-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    2628
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGAAGGCTCGCGAGGCTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_CaMKIIa_SERT_EYFP was a gift from Lin Tian (Addgene plasmid # 198737 ; http://n2t.net/addgene:198737 ; RRID:Addgene_198737)
  • For your References section:

    Psychedelics promote neuroplasticity through the activation of intracellular 5-HT2A receptors. Vargas MV, Dunlap LE, Dong C, Carter SJ, Tombari RJ, Jami SA, Cameron LP, Patel SD, Hennessey JJ, Saeger HN, McCorvy JD, Gray JA, Tian L, Olson DE. Science. 2023 Feb 17;379(6633):700-706. doi: 10.1126/science.adf0435. Epub 2023 Feb 16. 10.1126/science.adf0435 PubMed 36795823